Atf4 kda

Author: ukhq

August undefined, 2024

WebActivating transcription factor 4 (ATF4), is a stress-induced transcription factor, 1 encoded by the gene mapped to human chromosome 22q13.1. ATF4 is a member of ATF/CREB (cyclic AMP response element binding protein) family of basic region-leucine zipper (bZip) transcription factors. 2. This gene encodes a transcription factor that was ... WebPurpose: To determine concentrations of endoplasmic reticulum (ER) stress-related factors activating transcription factor 4 (ATF4) and glucose-regulated 78 kDa protein (GRP78) in …

ATF-6 (D4Z8V) Rabbit mAb Cell Signaling Technology

WebMay 31, 2010 · This suggests that the HIF and BCL2/adenovirus E1B 19-kDa protein-interacting protein 3 pathway may be less important under chronic and severe hypoxia … WebRecent studies have revealed that the central nervous system, particularly the hypothalamus, is critical for regulating insulin sensitivity in peripheral tissues. The aim of our current study is to investigate the possible involvement of hypothalamic activating transcription factor 4 (ATF4) in the r … fun activities to do with your partner

Anti-ATF-4 antibody (ab23760) is not available

WebHowever, CS-11815 detects a band with a mass of ~49 kDa, while the expected molecular weight of ATF4 is ~38 kDa. In contrast, SC-200 is a very dirty polyclonal antibody, but it seems to detect ATF4 as both a ~49 kDa band and a ~38 kDa band. I'm unaware of any long ATF4 splice variants or PTMs that might be responsible for this difference. WebAnti-ATF4 Antibody Anti-ATF4 is an antibody targeting the ATF4 protein, validated for use in WB & ChIP. - Find MSDS or SDS, a COA, data sheets and more information. United States / English; Quick Purchase; My Favorites ... The calculated molecular weight is 39 kDa; however, this protein may be observed at ~48 kDa in human tissue lysates and ~45 ... WebProduced recombinantly (animal-free) for high batch-to-batch consistency and long term security of supply; Rabbit monoclonal [EPR24346-182] to ATF-4 girdle composed of scapula and clavicle

ATF4 Polyclonal Antibody (10835-1-AP) - Thermo Fisher …

WebApr 12, 2024 · Background: Tocotrienol, a type of vitamin E, is well known for its anti-cancer and other biological activities. This systematic review aims to summarize the involvement of endoplasmic reticulum stress (ERS) and subsequent unfolded protein response (UPR) as the underlying molecular mechanisms for the anticancer properties of tocotrienol. … WebATF4 also regulates glucose homeostasis by suppressing beta-cell proliferation and insulin production. Furthermore, ATF4 targets the histone demethylase JMJD3 to alter chromatin structure and enhance gene transcription in response to amino acid deprivation. ... ~48 kDa observed. The calculated molecular weight is 39 kDa; however, this protein ... fun activities to get to know coworkersWebWestern Blot analysis of Rat Brain showing detection of ~39 kDa (isoform 2) ATF4 protein using Mouse Anti-ATF4 Monoclonal Antibody, Clone S360A-24 (SMC-447). Lane 1: Molecular Weight Ladder (MW). Lane 2: Rat Brain. Load: 15 µg. Block: 5% Skim Milk in 1X TBST. Primary Antibody: Mouse Anti-ATF4 Monoclonal Antibody (SMC-447) at 1:1000 … girdle c section

"Web1X10^6 HeLa cells were intracellularly stained with 0.4 ug Anti-Human ATF4 (60035-1-Ig, Clone:3E4C5) and CoraLite®488-Conjugated AffiniPure Goat Anti-Mouse IgG (H+L) at dilution 1:1000 (red), or 0.4 ug Control Antibody. Cells were fixed and permeabilized with Transcription Factor Staining Buffer Kit (PF00011). " - Atf4 kda

Atf4 kda

Anti-ATF4 Antibody ABE387 - EMD Millipore

WebDuring the UPR, PERK can phosphorylate eIF2α, the 90-kDa precursor of ATF6 is cleaved into a 50-kDa protein that functions as a transcription factor, and IRE1 splices a 26-bp intron from Xbp1u, resulting in an active Xbp1s. ... ATF4-F: ATGACCGAAATGAGCTTCCTG: ATF4-R: GCTGGAGAACCCATGAGGT: GADD34-F: GGAGGAAGAGAATCAAGCCA: … WebSep 28, 2024 · ER-resident 75 kDa glucose-regulated protein (GRP75) and mitochondrial voltage-dependent anion channel 1 (VDAC1) form a complex with subtype 3 of the 1, 4, 5-triphosphate receptor (IP3R3). ... Furthermore, strong binding of ATF4 to a 5′ upstream region of Sig1r was observed by a chromatin immunoprecipitation assay, suggesting that …

Did you know?

WebCara M. Anderson, Kay F. Macleod, in International Review of Cell and Molecular Biology, 2024 2.1.1 ATF4 induces autophagy during the integrated stress response. ATF4 is a basic leucine zipper (bZIP) stress-responsive transcription factor that belongs to the CREB/ATF family of transcription factors that are able to homodimerize or heterodimerize to regulate … WebBackground: ATF4. ATF4 is an approximately 38 kDa member of the bzip family of transcription factors. It plays an important role autophagy, the unfolded protein response, …

WebMar 21, 2024 · ATF4 (Activating Transcription Factor 4) is a Protein Coding gene. Diseases associated with ATF4 include Coffin-Lowry Syndrome and Fatty Liver Disease.Among its … WebSep 29, 2024 · ATF-4 Antibody (B-3) is an IgG 2b κ mouse monoclonal ATF-4 antibody (also designated ATF4 antibody, cAMP-dependent transcription factor ATF-4 antibody, …

WebWestern blot was performed using Anti-ATF4 Recombinant Rabbit Monoclonal Antibody (SD20-92) (Product # MA5-32364) and a 48 kDa band corresponding to ATF4 was … WebA 47 kDa band corresponding to ATF4 was observed in MDA-MB-231, MCF7 and T47D upon cell treatment. Western Blot analysis of ATF4 was performed by separating 30 µg of untreated (–) and treated (+) HeLa whole cell extracts by 10% SDS-PAGE. Proteins were transferred to a membrane and probed with a ATF4 Polyclonal Antibody (Product # …

WebThis antibody is a rabbit polyclonal antibody raised against full length human ATF4 antigen. The antibody recognizes the 38 kDa ATF4 protein and its phosphorylated forms (50 …

WebThe antibody recognizes the 38kd ATF4 protein and its phosphorylated forms (50kd). ATF4 can bind DNA as a homodimer and as a heterodimer. ATF4 is ubiquitinated by SCF (BTRC) in response to mTORC1 signal, followed by proteasomal degradation and leading to down-regulate expression of SIRT4, so the molecular weight of ATF4 may be 70 kDa. fun activities to release angerWebApr 4, 2024 · Part of ATF1-ATF4 transcription factor complex and ATF4-CREB1 transcription factor complex. Is expressed in several structures, including central nervous … fun activities to improve fine motor skillsWebCadmium exposure causes endoplasmic reticulum (ER) stress and accumulation of activating transcription factor 4 (ATF4), an ER stress marker. To elucidate the role of … fun activities to do with youth groupsWebER stress induces vascular calcification by increasing release of Grp78-loaded EVs. Our results reveal a novel mechanism of action of warfarin, involving increased EV release via the PERK-ATF4 pathway, contributing to calcification. This study is the first to show that warfarin induces ER stress and … fun activities to get to know staffWebDec 10, 2016 · C/EBP-homologous protein, CHOP or GADD153 (growth arrest and DNA damage 153), is another protein induced under conditions of severe ER stress by XBP1 and ATF4 (another UPR component). The 29 kDa CHOP is a member of the C/EBP family of transcription factors. fun activities to practice imperativesWebATF4 can bind DNA as a homodimer and as a heterodimer. ATF4 is ubiquitinated by SCF(BTRC) in response to mTORC1 signal, followed by proteasomal degradation and leading to down-regulate expression of SIRT4, so the molecular weight of … fun activities to do with your teamWebMar 22, 2024 · Moreover, the secretion of CCL2 in cancer milieu is regulated by activating transcription factor 4 (ATF4), ... (IFN) γ-induced protein; IP-10) is a 10 kDa protein functionally classified as a Th1 chemokine. It binds to the CXCR3 receptor and regulates the immune response by activating inflammatory cells such as T lymphocytes, eosinophils, … girdle designer whats my o